Research ArticleEditor’s Choice

Impact of Breathing Pattern and Nebulization on Expelled Viral Content During Mechanical Ventilation Using an Ex Vivo Porcine Lung System

Brian J Ring, Kareen Pestana, Vanna Sombatsaphay, Yvette Huet and Todd Steck
Respiratory Care October 2022, 67 (10) 1217-1225; DOI: https://doi.org/10.4187/respcare.09962

Abstract

BACKGROUND: Little is known about the fate of expelled viral particulates during the aerosolization of inhaled medications during mechanical ventilation. We hypothesized that breathing patterns that generate a greater degree of shear stress and turbulent air flow will produce a greater concentration of exhaled viral RNA with the presence of a nebulizer during mechanical ventilation.

METHODS: Eight ex vivo pig lungs were utilized as the physiological model. Each lung was dedicated to a specific breathing pattern that consisted of tidal breathing, respiratory distress, cough, and sneeze. Breath simulations were carried out through a commercial mechanical ventilator. Ninety mL of a bacteriophage stock at a concentration of 108 PFU/mL were introduced into the lungs during a 10-min sample collection session. The number of viral particles collected in exhalate was measured using quantitative polymerase chain reaction. The impact of breathing pattern on measured viruses was analyzed through two-way analysis of variance.

RESULTS: The interaction effect between nebulization and breath pattern on exhaled viral quantity was not statistically significant P = .80, partial η2 = 0.167. The analysis of the main effects indicated that the effects of the breathing pattern and nebulization phase were not statistically significant P = .26, partial η2 = 0.519; P = .98, partial η2 = 0, respectively. There were no statistically significant differences among the breathing patterns related to measurable viral RNA. Coughing produced the most measurable increase in measured viral quantity during the nebulization phase and non-nebulization phase with a mean exhaled viral quantity (3.5 × 105 ng/μL [95% CI 1.6 × 105–5.5 × 105] and 2.7 × 105 ng/μL [95% CI 7.1 × 103−5.5 × 105], respectively). Tidal breathing with the presence of a nebulizer and respiratory distress without a nebulizer produced the lowest measured viral quantities (M = 1.1 × 105 ng/μL [95% CI −1.7 × 105 to 3.9 × 105]; M = 1.2 × 105 ng/μL [95% CI −1.6 × 105 to 4.0 × 105]).

CONCLUSIONS: In this ex vivo porcine model, the introduction of a nebulizer did not increase the mean viral RNA captured throughout all of the breathing patterns.

Introduction

Bioaerosols are an ever-present vector of disease transmission from a natural and human-made etiology. As a causative factor, the attribution of bioaerosols to the development of chronic illness and the transmission of infectious pathogens in aerosol droplets is not a novel concept.1 Health care workers are at an increased risk of exposure to pathogenic bioaerosols from physiologic propulsion (eg, coughing, sneezing) as well as machine-generated particulates released from mechanical ventilators, aerosol medication administration, and other cardiopulmonary support mechanisms.2,3 In general, aerosolized medications, and lifesaving measures that generate pathogenic aerosols, are provided to those with chronic lung and vascular disease as well as patients with microbial colonization and viral infections. These instances are not mutually exclusive in the majority of cases.

With the emergence of SARS-CoV-2 and subsequent pandemic, many procedures suspected of generating pathogenic aerosols are suggested to be limited or significantly altered for a more invasive means of cardiopulmonary support (ie, reduction of the instances of noninvasive ventilatory support for invasive mechanical ventilation). This sentiment also applies to the nebulization of medications in the home and health care environment.4 Whereas there is limited evidence to support a complete omission of various aerosol-generating support mechanisms, it is not advised that the end user alter their treatment plan in cases associated with asthma and COPD.5,6 The risks associated with discontinuing aerosolized medication do not outweigh the conflicting body of evidence associated with the increased transmission risk of SARS-CoV-2 during these procedures.7

Droplet nuclei formation through aerosolized medication administration is not restricted to the nebulization device itself, or its exhaust, but also can be attributed to potential induction of cough from the patient or persons in the immediate environment. The role of coughing in virus-laden aerosol dispersion is multifaceted and encompasses a heterogenous body of evidence that seems to support both direct and indirect transmission of virus to individuals and surfaces through a wide range of particle size dispersion.8 Not all coughs are physiologically the same, and this applies to other forceful and passive exhalation maneuvers. As such, this phenomenon leads to the stratum of super-spreaders that generate higher viral loads per exhalation when compared to what is assumed to be an expected exhaled viral load.9 It is difficult to apply an average to a variable that is highly dependent on many physiological, environmental, and equipment-related influences; but in a laboratory environment, the standardization and extrapolation of viral signals through different breathing patterns and equipment interactions are a feasible endeavor.

Through the development of this novel, ex vivo, porcine model and a invasive mechanical ventilator, this investigation was designed to illustrate the impact of 4 common breath patterns in patients receiving inhaled aerosolized medication and the subsequent impact on viral RNA measurement. We hypothesized that breathing patterns that generate a greater degree of shear stress and turbulent air flow produce a greater concentration of exhaled viral RNA with the presence of a nebulizer during mechanical ventilation. This investigation aimed to evaluate the effect of nebulized medication delivery on exhaled viral quantity for mechanically ventilated patients.

QUICK LOOK

Current Knowledge

Aerosol-generating procedures are highlighted as potential sources of exposure to viral pathogens for health care professionals during the COVID-19 pandemic. The lack of consensus related to inhaled medication delivery, as it relates to viral exposure, contributes to alterations of aerosolized medication delivery strategies and potential adverse effects for patients. The negative impact of potentially unnecessary alterations in inhaled medication delivery may cause secondary impacts on medication adherence, dosing, and costs.

What This Paper Contributes to Our Knowledge

We demonstrated that in this ex vivo porcine model, the addition of a nebulizer to provide aerosol therapy did not increase the amount of viral RNA found in the environment. In this model using mechanical ventilation, breathing pattern did not alter the environmental contamination.

Methods

Study Objectives

The primary objective of this study was to determine the impact of nebulization on the presence of viral RNA during a 10-min aerosolized medication administration session in the immediate environment.

This experiment consisted of two phases of lung inflation trials. The first phase of this investigation explored the feasibility of the developed porcine model to serve as a control for the second phase of the project. Phase 2 introduced a nebulizer into the breathing circuit to determine the impact of the procedure of bacteriophage expression in exhaled breath. A total of 8 porcine lungs were used. All lung material was purchased from a retail processing facility and was sourced from animals slaughtered for meat production. This investigation’s protocol was reviewed and approved by the University of North Carolina at Charlotte Institutional Animal Care and Use Committee prior to conducting experiments.

Porcine Lung Model

The porcine lung has an anatomical structure that is sufficient to be utilized as a surrogate for the human lung; the porcine lung has a similar lobar structure (ie, multiple lobes), representation of the generations of the human tracheobronchial tree, and histological composition.10,11 These anatomical similarities are the cornerstone of translational clinical research as well as a tool to reduce exposure to pathogens, radiation, and other harmful agents/procedures in human subjects. Mechanical ventilation of the ex vivo porcine lung is physically feasible when an airway is introduced into the trachea and sealed to create a closed circuit in series with a pump (mechanical ventilator).12-14 Over the past decade, there have been multiple investigations regarding the ex vivo perfusion of lungs to provide insight on donor lung preservation and management to improve organ availability for those in need of lung transplantation; the ex vivo ventilation of the pig lungs in these lung perfusion studies has been conducted successfully for both volume and pressure control modes of mechanical ventilation.15

Propagation of MS2 Bacteriophage

Bacteriophage MS2 was chosen as a viable viral RNA tracer for this investigation due to the relative lack of immune stimulation, biological composition/structure, and its ability to be aerosolized and subsequently quantified upon exhalation.16,17

The bacteriophage host Escherichia coli strain C3000 (ATCC 15597) was cultured in flasks containing ATCC medium 271 under agitation at 37°C. Once the OD600nm reached 0.1 in an actively growing E. coli culture, 100 μL MS2 bacteriophage (ATCC 15597-B1) was added and allowed to incubate overnight at 37°C. The phage culture was then centrifuged at 4,000 g for 10 min, and the cell lysate supernatant was filtered in a 0.2-μm polyethersulfone sterile filter and stored at 4°C. Plaque assays were performed to measure phage amplification, which was determined to be approximately 1011 PFU per mL. The phage buffer was composed of 69 mL Tris-HCl 10 mM, pH 7.4, NaCl 100 mM, MgSO410 mM, and 1 mL phage lysate with an estimated 1010 PFU per mL.18

Breath Patterns

The 4 different breathing patterns consisted of tidal breathing, respiratory distress, cough, and sneeze. Tidal breathing and respiratory distress were characterized by a delivered tidal volume approximately 500 mL (8 mL/kg of average-sized adult male); breathing frequencies were 15 and 30 breaths/min, respectively. Coughing and sneezing were reproduced by a series of tidal breaths with an abrupt increase in extrapulmonary pressure to generate an expiratory flow 90–800 L/min at the end of inspiration. The expiratory phase of the cough was limited to 0.5 s; the sneeze was limited to 0.75 s for its expiratory phase.19 This pattern was repeated 5 times during the 10-min experiment trial for both the cough and sneeze maneuvers.

Lung Inflation and Aerosol Collection

The porcine model was developed from lungs extracted from farmed Yorkshire hybrid pigs with an average weight of 118 kg and 6 months of age (Animal Biotech Industries, Doylestown, Pennsylvania). The lungs were provided with the pleural membrane, trachea, and larynx attached. An inflation protocol was developed and initiated prior to beginning the breathing trials, which involved inflating the lungs in pressure-controlled mechanical ventilation with an inspiratory pressure 20 cm H2O, PEEP 20 cm H2O for 10 min, and breathing frequency 15 breaths/min. A size 7.5 endotracheal tube was utilized as the conduit for lung inflation. During the inflation procedure, the lungs were assessed for air leaks and repaired if necessary (> 100 mL inhaled tidal volume to exhaled tidal volume difference). All tissues used in the experiments were not treated with fixation agents prior to inflation. Ventilation was provided through the mechanical ventilator (Hamilton-G5, Hamilton Medical, Bonaduz, Switzerland); volume control ventilation was the primary mode of ventilation during the experimental trials.

Prior to inflation, the lungs were placed in the supine position at 30° relative to the bench space with a support ramp. The lungs were subjected to 4 different breathing patterns to generate different aerosol profiles during a 10-min breathing session, with a new lung utilized for each breathing trial. Airway temperature and humidity were provided and measured by MR850 humidification system (Fisher & Paykel Healthcare, Auckland, New Zealand) between 35°C–40°C. After completing the lung inflation protocol, 90 mL MS2 stock (108 PFU/mL) was instilled into the airways via the endotracheal tube. A schematic and image of the model can be seen in Figures 1 and 2.

Fig. 1.
Fig. 1.

Schematic of the elements of the model developed for this investigation for both phases of the experiment. Filtration of air, as shown in the diagram, occurs proximal to the endotracheal tube and nebulizer for phases 1 and 2, respectively. Events shaded gray were initiated in Phase 2 of the study.

Fig. 2.
Fig. 2.

Physical setup of the porcine model. The lungs are placed on a ramp to situate the lungs 30° relative to the bench surface. The connection between the ventilator circuit and the endotracheal tube is shown with the viral filter proximal to the endotracheal tube and distal to the Y-piece of the circuit connection. The background demonstrates the location of the mechanical ventilator used for the series of experiments.

During the breathing trials, exhaled aerosol was collected on a polypropylene bacterial and viral filter (Hudson RCI, Teleflex, Wayne, Pennsylvania) in the expiratory limb of the ventilator circuit. Immediately after ventilation sessions the 1-inch diameter filter that was exposed to exhaled aerosol was cut and deposited in a conical tube with 5 mL 1X phosphate-buffered saline and placed on a shaker at maximum velocity for 20 minutes at room temperature to elute MS2 bacteriophage from the filters.

Phase Two

Upon the completion of Phase 1 of the experiment, a modified nebulizer (LC Sprint, PARI, Starnberg, Germany) was introduced into the breathing circuit to provide the model with aerosolized albuterol sulfate (2.5 mg/3 mL) (Fig. 3). Phase 2 followed the same inflation, ventilation, and sample collection protocols that were outlined in the previous section.

Fig. 3.
Fig. 3.

The bottom black arrow indicates the location of the nebulizer in the ventilator circuit during Phase 2 of the experiment. The top red arrow in this image is the location of the viral filter to collect the simulated breath from the model.

RNA Extraction and cDNA Synthesis

RNA extraction was completed using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany). Modifications to the manufacturer’s protocol were done as suggested by a previous study, which noted a decrease in MS2 viral recovery.18 Complementary DNA (cDNA) synthesis was completed with Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific, Waltham, Massachusetts) per manufacturer’s protocols in a 20-μL solution composed of 4 μL of 5× Reaction Mix, 2 μL of Maxima Enzyme Mix, and 5 μg of extracted template RNA.

qPCR Detection of MS2

For the detection and quantification of the MS2 bacteriophage, previously established protocols were utilized.18 All quantitative polymerase chain reaction (qPCR) reactions were performed in triplicate with the Thermo Fisher QuantStudio 3 Real-Time PCR System. The 13-μL qPCR reaction mix was composed of 7 μL of 2× TaqMan Fast Advanced Master Mix (Applied Biosystems, Waltham, Massachusetts), 1 μM of forward primer (5′-GTCCATACCTTAGATGCG TTAGC-3′), 1 μM of reverse primer (5′-CCGTTAGCGAAGTTGCTTGG-3′), 150 μM of a dual-labeled probe (5′-/56-FAM/ACGTCGCCAGTTCCGCCATTGTCG/3BH), and 2 μL of the cDNA template. The amplification cycle was as follows: 94°C for 3 min followed by 35 cycles of 94°C for 15 s and 60°C for 1 min with a plate read after an elongation step.

Positive MS2 Controls

In order to isolate the MS2 amplicon, PCR was performed utilizing the same primers used in the qPCR protocol with similar conditions as previously described. Gel electrophoresis was used to separate the amplicons. The amplicon was then extracted from the gel using the QIAquick Gel Extraction Kit (QIAGEN). After this process, the amplicon was then quantified, and serial dilutions were performed and used to generate a standard curve.

Statistical Analysis

Statistical analysis was conducted through IBM SPSS Statistics for Mac, Version 27.0 (IBM, Armonk, New York). The main effects of this investigation and the comparison of group means were analyzed through factorial analysis of variance (ANOVA). In addition to the measurement of the main effects through factorial ANOVA, pairwise analysis of the simple effects was conducted to determine interactions between the individual variables. A priori power analysis (G*Power) concerning statistical outputs yielded a total of 25 sample measurements for a desired alpha 0.05 and power 0.80 (3 degrees of freedom). All P values are given for 2-tailed tests.

Results

A two-way ANOVA was conducted to examine the effects of the presence of a nebulizer and breathing pattern on measured viral quantities. Residual analysis was performed to test for the assumptions of the two-way ANOVA. Outliers were assessed by inspection of a boxplot; normality was assessed using Shapiro-Wilk normality test for each cell of the design, and homogeneity of variances was assessed by Levene test. There were no outliers; residuals were normally distributed, and there was homogeneity of variances (P = .05).

The interaction effect between nebulization and breath pattern on measured viral quantity was not statistically significant P = .80, partial η2 = 0.167. Therefore, an analysis of the main effects for breath pattern and nebulization phase was performed. The analysis of the main effects indicated that the effects of the breath pattern and nebulization phase were not statistically significant P = .26, partial η2 = 0.519; and P = .98, partial η2 = 0, respectively. All pairwise comparisons were run, reported 95% CI and P values are Bonferroni adjusted. The unweighted marginal means of measured viral concentrations (ng/μL) for the breath patterns of tidal breathing, respiratory distress, coughing, and sneezing were 1.21 × 105 ng/μL (SE = 7.7 × 104), 1.3 × 105 ng/μL (SE = 6.3 × 104), 3.1 × 105 ng/μL (SE = 6.6 × 104), and 1.6 × 105 ng/μL (SE = 6.3 × 104), respectively. The unweighted marginal means of exhaled viral quantity for the nebulization phases of the presence of a nebulizer and the absence of a nebulizer were 1.8 × 105 ng/μL (SE = 4.6 × 104) and 1.8 × 105 ng/μL (SE = 5.0 × 104), respectively.

All pairwise comparisons among the breath patterns, as well as between nebulizer phases, did not reveal statistically significant mean differences in measured viral quantity (Fig. 4). Of note, the presence of a nebulizer was associated with the reduction of mean measured viral quantity (1.8 × 103 ng/μL [95% CI −1.7 × 105 to 1.7 × 105], P = .98) but with minimal clinical relevance. Whereas there were no statistically significant differences among the breathing patterns related to measurable viral RNA, coughing produced the most measurable increase in captured viral quantity during the nebulization phase and non-nebulization phase with a mean measured viral quantity (3.5 × 105 ng/μL [95% CI 1.6 × 105–5.5 × 105] and 2.7 × 105 ng/μL [95% CI 7.1 × 103−5.5 × 105], respectively). Tidal breathing with the presence of a nebulizer and respiratory distress without a nebulizer produced the lowest exhaled viral quantities (M = 1.1 × 105 ng/μL [95% CI −1.7 × 105 to 3.9 × 105]; and M = 1.2 × 105 ng/μL [95% CI −1.6 × 105 to 4.0 × 105]).

Fig. 4.
Fig. 4.

Viral quantity as measured by quantitative polymerase chain reaction during each of the 4 different breathing patterns. The samples collected from the model were run in triplicate to calculate desired parameters and standard error bars shown in the graph (of note, samples that only had one valid measurement do not have an associated standard error [SE]). Measured viral quantity (ng/μL) was not significantly different among the 4 breathing patterns with and without the nebulizer present (P > .05). Error bars denote ± 2 SE.

Descriptive statistics associated with captured viral quantity (ng/μL) in each breathing pattern and nebulizer phase are expressed by the means and SD in Table 1.

View this table:
Table 1.

Exhaled Viral Quantity by Breath Pattern and Phase

Discussion

In line with current reports of the contribution of aerosol-generating procedures and the distribution of viral particulates into the immediate environment, this investigation demonstrated that the introduction of a nebulizer in the breathing circuit of this porcine lung model did not increase the viral deposition on the filter during the expiratory phase of the breath during simulated coughing.20,21 In conjunction with this overarching finding, it was found that different breathing patterns produced varying levels of measured viral particulates that can be stratified into coughing—generating the most measured viral particulates—and tidal breathing, with a nebulizer in line producing the least (Table 1). This finding is not necessarily surprising from the perspective that the physiological mechanism of a cough is to expel pathogens from the tracheobronchial tree and generate a high degree of shear stress in the airways.

There are many considerations when assessing the etiology of viral transmission during the exhalation phase of the breath. In the context of this experiment, a hypothesized source of viral contamination, and thus spread, is the nebulizer itself. This assumption is an extrapolation of information related to nebulization and microbial contaminants found in nebulizers used by patients with cystic fibrosis and the stability of SARS-CoV-2 on plastics.22,23 In theory, this is a proposed avenue of SARS-CoV-2 transmission that has yet to be fully elucidated through scientific exploration. For each breath pattern, a new set of lungs and equipment was utilized to reduce the compounding effects, and mismeasurement, secondary to viral adhesion to various parts of the ventilator and associated equipment; therefore, we cannot safely assume that the nebulizer has functioned as a viral reservoir for the bacteriophage in this model. This investigation did demonstrate mixed, although not statistically significant, results when a nebulizer was introduced to the breathing circuit during different breathing patterns. In the context of mechanical ventilation and medication nebulization, this investigation provides the perspective of potential viral RNA exposure during accidental, or purposeful, ventilator circuit disconnections that are a common occurrence in critical-care environments.

Nebulization of medication is considered an aerosol-generating procedure and, as such, has inspired the use of alternative aerosolized medication delivery regardless of the lack of a strong evidence base.24 Nebulization of inhaled medications is of concern because of aerosol dispersion versus generation; in essence, it is assumed that the nebulizer is acting as a distribution amplifier during the breathing patterns addressed in this investigation.25,26

Assumptions regarding nebulization and the enhancement of viral transmission, especially in the context of SARS-CoV-2, have created a set of theories that has translated into the change in practice in many health care facilities without consideration for the risks that these changes may have on patient care. For example, an alternative for the nebulization of aerosolized medications is the use of a pressurized metered-dose inhaler (pMDI). The pMDI requires coordination between the actuation of the device in coordination with the patient’s breath. This is unachievable for patients with disorders such as neuromuscular disease, developmental issues, or simply lack the ability to use the pMDI effectively. During mechanical ventilation, the reliance on the practitioner to provide pMDI actuation, and timing with the breath, may exhibit the same issues as stated with self-administration. Finally, the precipitation of cough from inhaled medications is considered a primary source of viral transmission from the user to the environment; changing medication delivery devices does not mitigate this risk.27

Airway anatomy and physiology are major determinants in exhaled aerosol characteristics and viral transmission. This investigation focused primarily on the impact of the lower airway of the porcine lung in the generation of viral RNA through simulated tidal breathing, respiratory distress, coughing, and sneezing. A primary consideration is the standardization of these breathing patterns in the context of the human patient. For example, not every cough is the same, nor does it generate the same shear stress and expiratory force for every maneuver. There is also distinct variation in the structures of the upper airway from subject to subject. Furthermore, the structures of the upper airway (more specifically the oral cavity) generate large particle sizes that settle out of suspension more quickly than particles that are formed in the lower airways.28 In this context, the isolation of the lower airway from the upper airway (ie, oropharynx, nasopharynx) was an appropriate method to standardize the particle sizes of interest that are commonly generated by the structures of the lower airway. Although bypassing the structures of the upper airways presents as one of the limitations of this investigation, the modeling of the human tracheobronchial tree through the development of a porcine model provides an approximation of the characteristics of exhaled gasses and, as such, viral transmission with a bacteriophage signal.29

Whereas the findings of this investigation are potentially useful in the decision-making processes related to the nebulization of aerosolized medications, there are significant limitations of this investigation. The translation from an ex vivo porcine lung model to the human is not well defined in this specific capacity. Furthermore, the incorporation of a mechanical ventilator, ventilator circuit, and associated potential alteration on viral deposition in aerosol needs to be considered, although the study design employed strategies to attempt to mitigate these effects.

The validation of the model developed for this investigation was based on the initial measurements provided during Phase 1 of the experiment; a robust description of the methods was made available to promote the reproduction of this experiment for further validation of this novel porcine model. The ability to quantify viral particles in exhalate via qPCR analysis provided the confidence to move forward with the second phase of this work and dissemination of findings. This investigation incorporated a proof-of-concept approach to determine clinically relevant outcomes related to aerosol-generating procedures, pulmonary physiology, and viral infection in the context of mechanical ventilation and the administration of aerosolized medications; further translational investigations using similar techniques need to be conducted to improve the validity of our specific approach. Finally, the infectivity of the exhaled viral RNA was not analyzed. Despite these limitations, we can conclude that the use of a nebulizer to deliver aerosolized medication does not necessarily increase the amount of exhaled viral RNA in this investigation.

Conclusions

This investigation was developed to compare the impact of nebulization during four common breathing patterns found in a clinical environment on exhaled viral RNA expression from the proximal airway during mechanical ventilation. Our findings suggest that there is not a statistically significant difference, or increase, in the amount of exhaled viral RNA during simulated tidal breathing, respiratory distress, coughing, and sneezing in this model with or without a nebulizer present in the circuit. Further study is needed to determine if the use of a nebulizer demonstrates an increase in infectious viral concentrations in exhaled breath during aerosolized medication administration.

Footnotes

  • Correspondence: Brian J Ring MSc RRT RRT-ACCS RRT-NPS, Department of Applied Physiology, Health, and Clinical Sciences, University of North Carolina at Charlotte, 9201 University City Boulevard, Belk 222, Charlotte, NC 28223. E-mail: brian.ring44{at}gmail.com

  • See the Related Editorial on Page 1361

  • Mr Ring previously served as editorial intern for Respiratory Care. The remaining authors have disclosed no conflicts of interest.

  • This work was supported through funding from Theravance Biopharma, Dublin, Ireland.

REFERENCES

  1. 1.↵
    1. Hauswirth DW,
    2. Sundy JS
    . Bioaerosols and innate immune responses in airway diseases. Curr Opin Allergy Clin Immunol 2004;4(5):361-366.
    OpenUrlPubMed
  2. 2.↵
    1. Soma M,
    2. Jacobson I,
    3. Brewer J,
    4. Blondin A,
    5. Davidson G,
    6. Singham S
    . Operative team checklist for aerosol generating procedures to minimize exposure of health care workers to SARS-CoV-2. Int J Pediatr Otorhinolaryngol 2020;134:110075.
    OpenUrl
  3. 3.↵
    1. Blachere FM,
    2. Lindsley WG,
    3. Pearce TA,
    4. Anderson SE,
    5. Fisher M,
    6. Khakoo R,
    7. et al
    . Measurement of airborne influenza virus in a hospital emergency department. Clin Infect Dis 2009;48(4):438-440.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Benge CD,
    2. Barwise JA
    . Aerosolization of COVID-19 and contamination risks during respiratory treatments. Fed Pract 2020;37(4):160-163.
    OpenUrl
  5. 5.↵
    Global Initiative for Asthma (GINA). COVID-19: GINA answers to frequently asked questions on asthma management. Available at: https://ginasthma.org/covid-19-gina-answers-to-frequently-asked-questions-on-asthma-management.
  6. 6.↵
    World Health Organization. Coronavirus disease (COVID-19) technical guidance: patient management, 2020.
  7. 7.↵
    1. Chu DK,
    2. Akl EA,
    3. Duda S,
    4. Solo K,
    5. Yaacoub S,
    6. Schünemann HJ
    ; COVID-19 Systematic Urgent Review Group Effort (SURGE) study authors. Physical distancing, face masks, and eye protection to prevent person-to-person transmission of SARS-CoV-2 and COVID-19: a systematic review and meta-analysis. Lancet 2020;395(10242):1973-1987.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Bourouiba L,
    2. Dehandschoewercker E,
    3. Bush JW
    . Violent expiratory events: on coughing and sneezing. J Fluid Mech 2014;745:537-563.
    OpenUrl
  9. 9.↵
    1. Lloyd-Smith JO,
    2. Schreiber SJ,
    3. Kopp PE,
    4. Getz WM
    . Super-spreading and the effect of individual variation on disease emergence. Nature 2005;438(7066):355-359.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Manunta MDI,
    2. McAnulty RJ,
    3. McDowell A,
    4. Jin J,
    5. Ridout D,
    6. Fleming J,
    7. et al
    . Airway deposition of nebulized gene delivery nanocomplexes monitored by radio-imaging agents. Am J Respir Cell Mol Biol 2013;49(3):471-480.
    OpenUrl
  11. 11.↵
    1. Judge EP,
    2. Hughes JML,
    3. Egan JJ,
    4. Maguire M,
    5. Molloy EL,
    6. O'Dea S
    . Anatomy and bronchoscopy of the porcine lung. A model for translational respiratory medicine. Am J Respir Cell Mol Biol 2014;51(3):334-343.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Klassen C,
    2. Eckert CE,
    3. Wong J,
    4. Guyette JP,
    5. Harris JL,
    6. Thompson S,
    7. et al
    . Ex vivo modeling of perioperative air leaks in porcine lungs. IEEE Trans Biomed Eng 2018;65(12):2827-2836.
    OpenUrlCrossRef
  13. 13.
    1. Perinel S,
    2. Pourchez J,
    3. Leclerc L,
    4. Avet J,
    5. Durand M,
    6. Prévôt N,
    7. et al
    . Development of an ex vivo human-porcine respiratory model for preclinical studies. Sci Rep 2017;7:43121.
    OpenUrl
  14. 14.↵
    1. Dutta R,
    2. Xing T,
    3. Murdoch GK
    . Comparison of pressure, volume, and gas wash-out characteristics between PCV and HFPV in healthy and formalin-fixed ex vivo porcine lungs. Physiol Meas 2018;39(9):095003.
    OpenUrl
  15. 15.↵
    1. Mehaffey JH,
    2. Charles EJ,
    3. Sharma AK,
    4. Money DT,
    5. Zhao Y,
    6. Stoler MH,
    7. et al
    . Airway pressure release ventilation during ex vivo lung perfusion attenuates injury. J Thorac Cardiovasc Surg 2017;153(1):197-204.
    OpenUrl
  16. 16.↵
    1. Turgeon N,
    2. Toulouse M-J,
    3. Martel B,
    4. Moineau S,
    5. Duchaine C
    . Comparison of five bacteriophages as models for viral aerosol studies. Appl Environ Microbiol 2014;80(14):4242-4250.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Eninger RM,
    2. Honda T,
    3. Adhikari A,
    4. Heinonen-Tanski H,
    5. Reponen T,
    6. Grinshpun SA
    . Filter performance of n99 and n95 face-piece respirators against viruses and ultrafine particles. Ann Occup Hyg 2008;52(5):385-396.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Gendron L,
    2. Verreault D,
    3. Veillette M,
    4. Moineau S,
    5. Duchaine C
    . Evaluation of filters for the sampling and quantification of RNA phage aerosols. Aerosol Sci Technol 2010;44(10):893-901.
    OpenUrlCrossRef
  19. 19.↵
    1. Ross BB,
    2. Gramiak R,
    3. Rahn H
    . Physical dynamics of the cough mechanism. J Appl Physiol 1955;8(3):264-268.
    OpenUrlPubMed
  20. 20.↵
    1. Bem RA,
    2. van Mourik N,
    3. Klein-Blommert R,
    4. Spijkerman IJ,
    5. Kooij S,
    6. Bonn D,
    7. Vlaar AP
    . Risk of aerosol formation during high-flow nasal cannula treatment in critically ill subjects. Respir Care 2021;66(6):891-896.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Avari H,
    2. Hiebert RJ,
    3. Ryzynski AA,
    4. Levy A,
    5. Nardi J,
    6. Kanji-Jaffer H,
    7. et al
    . Quantitative assessment of viral dispersion associated with respiratory support devices in a simulated critical-care environment. Am J Respir Crit Care Med 2021;203(9):1112-1118.
    OpenUrl
  22. 22.↵
    1. Blau H,
    2. Mussaffi H,
    3. Mei Zahav M,
    4. Prais D,
    5. Livne M,
    6. Czitron BM,
    7. et al
    . Microbial contamination of nebulizers in the home treatment of cystic fibrosis. Child Care Health Dev 2007;33(4):491-495.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Van Doremalen N,
    2. Bushmaker T,
    3. Morris DH,
    4. Holbrook MG,
    5. Gamble A,
    6. Williamson BN,
    7. et al
    . Aerosol and surface stability of SARS-CoV-2 as compared with SARS-CoV-1. N Engl J Med 2020;382(16):1564-1567.
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Tran K,
    2. Cimon K,
    3. Severn M,
    4. Pessoa-Silva CL,
    5. Conly J
    . Aerosol-generating procedures and risk of transmission of acute respiratory infections to health care workers: a systematic review. PloS One 2012;7(4):e35797.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Reychler G,
    2. Vecellio L,
    3. Dubus JC
    ; ‘group Aerosoltherapy GAT’ of the French Language Respiratory Society-Société de Pneumologie de Langue Française SPLF. Nebulization: a potential source of SARS-CoV-2 transmission. Respir Med Res 2020;78:100778.
    OpenUrlCrossRef
  26. 26.↵
    1. Amirav I,
    2. Newhouse MT
    . Transmission of coronavirus by nebulizer: a serious, underappreciated risk. CMAJ 2020;192(13):E346.
    OpenUrlFREE Full Text
  27. 27.↵
    1. Mei-Zahav M,
    2. Amirav I
    . Aerosol treatments for childhood asthma in the era of COVID-19. Pediatr Pulmonol 2020;55(8):1871-1872.
    OpenUrl
  28. 28.↵
    1. Dhand R,
    2. Li J
    . Coughs and sneezes: their role in transmission of respiratory viral infections, including SARS-CoV-2. Am J Respir Crit Care Med 2020;202(5):651-659.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Wiggs BR,
    2. Bosken C,
    3. Paré PD,
    4. James A,
    5. Hogg JC
    . A model of airway narrowing in asthma and in chronic obstructive pulmonary disease. Am Rev Respir Dis 1992;145(6):1251-1258.
    OpenUrlCrossRefPubMed
Back to top

In this issue

 

Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section

Related Articles

Cited By...

Keywords